|   | cutseq | 
This simple editing program allows you to cut out a region from your sequence by specifying the begin and end positions of the region to remove. It removes the sequence from the specified start to the end positions (inclusive) and writes the remaining sequence to the output file.
To remove bases 10 to 12 from a database entry and write to the new sequence file 'gatta2.seq':
| % cutseq tembl:x13776 gatta2.seq -from=10 -to=12 Removes a section from a sequence | 
Go to the input files for this example
Go to the output files for this example
Example 2
To remove the first 20 bases from 'tembl:x13776' and write it to 'jsh.seq':
| % cutseq tembl:x13776 -from=1 -to=20 -out=jsh.seq Removes a section from a sequence | 
Go to the output files for this example
Example 3
If the default start and end positions are accepted, then all of the sequence is removed!
| % cutseq tembl:x13776 starta.seq -sbeg=-1000 -send=1290 Removes a section from a sequence Start of region to delete [1168]: End of region to delete [1290]: | 
Go to the output files for this example
| 
   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   (Gapped) sequence filename and optional
                                  format, or reference (input USA)
   -from               integer    [Start of sequence (0)] This is the start
                                  position (inclusive) of the section of the
                                  sequence that you wish to remove. (Any
                                  integer value)
   -to                 integer    [End of sequence (0)] This is the end
                                  position (inclusive) of the section of the
                                  sequence that you wish to remove. (Any
                                  integer value)
  [-outseq]            seqout     [ | 
| Standard (Mandatory) qualifiers | Allowed values | Default | |
|---|---|---|---|
| [-sequence] (Parameter 1) | (Gapped) sequence filename and optional format, or reference (input USA) | Readable sequence | Required | 
| -from | This is the start position (inclusive) of the section of the sequence that you wish to remove. | Any integer value | Start of sequence (0) | 
| -to | This is the end position (inclusive) of the section of the sequence that you wish to remove. | Any integer value | End of sequence (0) | 
| [-outseq] (Parameter 2) | Sequence filename and optional format (output USA) | Writeable sequence | <*>.format | 
| Additional (Optional) qualifiers | Allowed values | Default | |
| (none) | |||
| Advanced (Unprompted) qualifiers | Allowed values | Default | |
| (none) | |||
| 
ID   X13776; SV 1; linear; genomic DNA; STD; PRO; 2167 BP.
XX
AC   X13776; M43175;
XX
DT   19-APR-1989 (Rel. 19, Created)
DT   14-NOV-2006 (Rel. 89, Last updated, Version 24)
XX
DE   Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW   aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS   Pseudomonas aeruginosa
OC   Bacteria; Proteobacteria; Gammaproteobacteria; Pseudomonadales;
OC   Pseudomonadaceae; Pseudomonas.
XX
RN   [1]
RP   1167-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
RN   [2]
RP   1167-2167
RX   DOI; 10.1016/0014-5793(89)80249-2.
RX   PUBMED; 2495988.
RA   Lowe N., Rice P.M., Drew R.E.;
RT   "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomonas
RT   aeruginosa";
RL   FEBS Lett. 246(1-2):39-43(1989).
XX
RN   [3]
RP   1-1292
RX   PUBMED; 1907262.
RA   Wilson S., Drew R.;
RT   "Cloning and DNA seqence of amiC, a new gene regulating expression of the
RT   Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT   product.";
RL   J. Bacteriol. 173(16):4914-4921(1991).
XX
RN   [4]
RP   1-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG.
XX
DR   GOA; Q51417.
DR   UniProtKB/Swiss-Prot; Q51417; AMIS_PSEAE.
XX
  [Part of this file has been deleted for brevity]
FT                   /replace=""
FT                   /note="ClaI fragment deleted in pSW36,  constitutive
FT                   phenotype"
FT   misc_feature    1
FT                   /note="last base of an XhoI site"
FT   misc_feature    648..653
FT                   /note="end of 658bp XhoI fragment, deletion in  pSW3 causes
FT                   constitutive expression of amiE"
FT   conflict        1281
FT                   /replace="g"
FT                   /citation=[3]
XX
SQ   Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
     ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat        60
     ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac       120
     aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg       180
     aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg       240
     agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc       300
     ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg       360
     tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg       420
     agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga       480
     acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga       540
     ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa       600
     gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct       660
     acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg       720
     cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg       780
     ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg       840
     aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       900
     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       960
     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      1020
     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      1080
     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      1140
     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      1200
     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      1260
     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      1320
     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      1380
     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      1440
     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      1500
     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      1560
     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      1620
     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      1680
     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      1740
     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      1800
     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      1860
     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      1920
     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      1980
     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      2040
     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      2100
     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      2160
     cctcgag                                                                2167
//
 | 
| >X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation ggtaccgctcgagcatctgctcgatcaccaccagccgggcgacgggaactgcacgatcta cctggcgagcctggagcacgagcgggttcgcttcgtacggcgctgagcgacagtcacagg agaggaaacggatgggatcgcaccaggagcggccgctgatcggcctgctgttctccgaaa ccggcgtcaccgccgatatcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagc aactgaaccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggaccccg gcggcgacccggaccgctatcggctgtgcgccgaggacttcattcgcaaccggggggtac ggttcctcgtgggctgctacatgtcgcacacgcgcaaggcggtgatgccggtggtcgagc gcgccgacgcgctgctctgctacccgaccccctacgagggcttcgagtattcgccgaaca tcgtctacggcggtccggcgccgaaccagaacagtgcgccgctggcggcgtacctgattc gccactacggcgagcgggtggtgttcatcggctcggactacatctatccgcgggaaagca accatgtgatgcgccacctgtatcgccagcacggcggcacggtgctcgaggaaatctaca ttccgctgtatccctccgacgacgacttgcagcgcgccgtcgagcgcatctaccaggcgc gcgccgacgtggtcttctccaccgtggtgggcaccggcaccgccgagctgtatcgcgcca tcgcccgtcgctacggcgacggcaggcggccgccgatcgccagcctgaccaccagcgagg cggaggtggcgaagatggagagtgacgtggcagaggggcaggtggtggtcgcgccttact tctccagcatcgatacgcccgccagccgggccttcgtccaggcctgccatggtttcttcc cggagaacgcgaccatcaccgcctgggccgaggcggcctactggcagaccttgttgctcg gccgcgccgcgcaggccgcaggcaactggcgggtggaagacgtgcagcggcacctgtacg acatcgacatcgacgcgccacaggggccggtccgggtggagcgccagaacaaccacagcc gcctgtcttcgcgcatcgcggaaatcgatgcgcgcggcgtgttccaggtccgctggcagt cgcccgaaccgattcgccccgacccttatgtcgtcgtgcataacctcgacgactggtccg ccagcatgggcgggggaccgctcccatgagcgccaactcgctgctcggcagcctgcgcga gttgcaggtgctggtcctcaacccgccgggggaggtcagcgacgccctggtcttgcagct gatccgcatcggttgttcggtgcgccagtgctggccgccgccggaagccttcgacgtgcc ggtggacgtggtcttcaccagcattttccagaatggccaccacgacgagatcgctgcgct gctcgccgccgggactccgcgcactaccctggtggcgctggtggagtacgaaagccccgc ggtgctctcgcagatcatcgagctggagtgccacggcgtgatcacccagccgctcgatgc ccaccgggtgctgcctgtgctggtatcggcgcggcgcatcagcgaggaaatggcgaagct gaagcagaagaccgagcagctccaggaccgcatcgccggccaggcccggatcaaccaggc caaggtgttgctgatgcagcgccatggctgggacgagcgcgaggcgcaccagcacctgtc gcgggaagcgatgaagcggcgcgagccgatcctgaagatcgctcaggagttgctgggaaa cgagccgtccgcctgagcgatccgggccgaccagaacaataacaagaggggtatcgtcat catgctgggactggttctgctgtacgttggcgcggtgctgtttctcaatgccgtctggtt gctgggcaagatcagcggtcgggaggtggcggtgatcaacttcctggtcggcgtgctgag cgcctgcgtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaaggc cggagcgctgaccctgctattcgcttttacctatctgtgggtggccgccaaccagttcct cgag | 
| >X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation tgctcgatcaccaccagccgggcgacgggaactgcacgatctacctggcgagcctggagc acgagcgggttcgcttcgtacggcgctgagcgacagtcacaggagaggaaacggatggga tcgcaccaggagcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaaccgcgagggc ggcgtcggcggtcgcccgatcgaaacgctgtcccaggaccccggcggcgacccggaccgc tatcggctgtgcgccgaggacttcattcgcaaccggggggtacggttcctcgtgggctgc tacatgtcgcacacgcgcaaggcggtgatgccggtggtcgagcgcgccgacgcgctgctc tgctacccgaccccctacgagggcttcgagtattcgccgaacatcgtctacggcggtccg gcgccgaaccagaacagtgcgccgctggcggcgtacctgattcgccactacggcgagcgg gtggtgttcatcggctcggactacatctatccgcgggaaagcaaccatgtgatgcgccac ctgtatcgccagcacggcggcacggtgctcgaggaaatctacattccgctgtatccctcc gacgacgacttgcagcgcgccgtcgagcgcatctaccaggcgcgcgccgacgtggtcttc tccaccgtggtgggcaccggcaccgccgagctgtatcgcgccatcgcccgtcgctacggc gacggcaggcggccgccgatcgccagcctgaccaccagcgaggcggaggtggcgaagatg gagagtgacgtggcagaggggcaggtggtggtcgcgccttacttctccagcatcgatacg cccgccagccgggccttcgtccaggcctgccatggtttcttcccggagaacgcgaccatc accgcctgggccgaggcggcctactggcagaccttgttgctcggccgcgccgcgcaggcc gcaggcaactggcgggtggaagacgtgcagcggcacctgtacgacatcgacatcgacgcg ccacaggggccggtccgggtggagcgccagaacaaccacagccgcctgtcttcgcgcatc gcggaaatcgatgcgcgcggcgtgttccaggtccgctggcagtcgcccgaaccgattcgc cccgacccttatgtcgtcgtgcataacctcgacgactggtccgccagcatgggcggggga ccgctcccatgagcgccaactcgctgctcggcagcctgcgcgagttgcaggtgctggtcc tcaacccgccgggggaggtcagcgacgccctggtcttgcagctgatccgcatcggttgtt cggtgcgccagtgctggccgccgccggaagccttcgacgtgccggtggacgtggtcttca ccagcattttccagaatggccaccacgacgagatcgctgcgctgctcgccgccgggactc cgcgcactaccctggtggcgctggtggagtacgaaagccccgcggtgctctcgcagatca tcgagctggagtgccacggcgtgatcacccagccgctcgatgcccaccgggtgctgcctg tgctggtatcggcgcggcgcatcagcgaggaaatggcgaagctgaagcagaagaccgagc agctccaggaccgcatcgccggccaggcccggatcaaccaggccaaggtgttgctgatgc agcgccatggctgggacgagcgcgaggcgcaccagcacctgtcgcgggaagcgatgaagc ggcgcgagccgatcctgaagatcgctcaggagttgctgggaaacgagccgtccgcctgag cgatccgggccgaccagaacaataacaagaggggtatcgtcatcatgctgggactggttc tgctgtacgttggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgcgtcgcgttct acctgatcttttccgcagcagccgggcagggctcgctgaaggccggagcgctgaccctgc tattcgcttttacctatctgtgggtggccgccaaccagttcctcgag | 
| >X13776 X13776.1 Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation | 
Qualifiers that are in-built for sequence datatypes allow the input and output files to be specified in more detail, for example, the format for the output files.
| Program name | Description | 
|---|---|
| aligncopy | Reads and writes alignments | 
| aligncopypair | Reads and writes pairs from alignments | 
| biosed | Replace or delete sequence sections | 
| codcopy | Copy and reformat a codon usage table | 
| degapseq | Removes non-alphabetic (e.g. gap) characters from sequences | 
| descseq | Alter the name or description of a sequence | 
| entret | Retrieves sequence entries from flatfile databases and files | 
| extractalign | Extract regions from a sequence alignment | 
| extractfeat | Extract features from sequence(s) | 
| extractseq | Extract regions from a sequence | 
| featcopy | Reads and writes a feature table | 
| featreport | Reads and writes a feature table | 
| listor | Write a list file of the logical OR of two sets of sequences | 
| makenucseq | Create random nucleotide sequences | 
| makeprotseq | Create random protein sequences | 
| maskambignuc | Masks all ambiguity characters in nucleotide sequences with N | 
| maskambigprot | Masks all ambiguity characters in protein sequences with X | 
| maskfeat | Write a sequence with masked features | 
| maskseq | Write a sequence with masked regions | 
| newseq | Create a sequence file from a typed-in sequence | 
| nohtml | Remove mark-up (e.g. HTML tags) from an ASCII text file | 
| noreturn | Remove carriage return from ASCII files | 
| nospace | Remove all whitespace from an ASCII text file | 
| notab | Replace tabs with spaces in an ASCII text file | 
| notseq | Write to file a subset of an input stream of sequences | 
| nthseq | Write to file a single sequence from an input stream of sequences | 
| pasteseq | Insert one sequence into another | 
| revseq | Reverse and complement a nucleotide sequence | 
| seqret | Reads and writes (returns) sequences | 
| seqretsplit | Reads sequences and writes them to individual files | 
| sizeseq | Sort sequences by size | 
| skipredundant | Remove redundant sequences from an input set | 
| skipseq | Reads and writes (returns) sequences, skipping first few | 
| splitter | Split sequence(s) into smaller sequences | 
| trimest | Remove poly-A tails from nucleotide sequences | 
| trimseq | Remove unwanted characters from start and end of sequence(s) | 
| trimspace | Remove extra whitespace from an ASCII text file | 
| union | Concatenate multiple sequences into a single sequence | 
| vectorstrip | Removes vectors from the ends of nucleotide sequence(s) | 
| yank | Add a sequence reference (a full USA) to a list file |